shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(SAMD13-shRNA-Seq2)(CAT#: AdV-SI0450WQ)

This product is a SAMD13-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The expression of SAMD13-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert SAMD13-shRNA-Seq2
Related Target/Protein SAMD13
Region CDS
TargetSeq GATGTCGTCAATTATTTCCGA
NCBI RefSeq NM_001010971
Alternative Names HSD-41; HSD-42
Titer >1*10^10 GC/mL
Related Diseases Breast Cancer
Target Gene
Gene ID 148418
Uniprot ID Q5VXD3

Related Products