shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(Scap-shRNA-Seq1)(CAT#: AdV-SI2281WQ)

This product is a Scap-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The Scap gene encodes a protein with a sterol sensing domain (SSD) and seven WD domains. In the presence of cholesterol, this protein binds to sterol regulatory element binding proteins (SREBPs) and mediates their transport from the ER to the Golgi. The expression of Scap-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert Scap-shRNA-Seq1
Related Target/Protein Scap
Region CDS
TargetSeq CATCCTGTTTGCCTACATCTA
NCBI RefSeq NM_001001144
Titer >1*10^10 GC/mL
Target Gene
Gene ID 22937
Uniprot ID Q12770

Related Products