shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(SERINC5-shRNA-Seq1)(CAT#: AdV-SI0496WQ)
This product is a SERINC5-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The SERINC5 gene impairs the penetration of the viral particle into the cytoplasm and enhances the incorporation of serine into phosphatidylserine and sphingolipids. May play a role in providing serine molecules for the formation of myelin glycosphingolipids in oligodendrocytes. The expression of SERINC5-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | SERINC5-shRNA-Seq1 |
| Related Target/Protein | SERINC5 |
| Region | CDS |
| TargetSeq | CACCGTCTACATCTACTCCTA |
| NCBI RefSeq | NM_178276 |
| Alternative Names | TPO1; C5orf12 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | HIV infection |