shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(SF3B4-shRNA-Seq1)(CAT#: AdV-SI0039WQ)

This product is a SF3B4-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The protein encoded by SF3B4 gene cross-links to a region in the pre-mRNA immediately upstream of the branchpoint sequence in pre-mRNA in the prespliceosomal complex A. It also may be involved in the assembly of the B, C and E spliceosomal complexes. In addition to RNA-binding activity, this protein interacts directly and highly specifically with subunit 2 of the splicing factor 3B. The expression of SF3B4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert SF3B4-shRNA-Seq1
Related Target/Protein SF3B4
Region CDS
TargetSeq CCGTCCTATCACCGTATCTTA
NCBI RefSeq NM_005850
Alternative Names AFD1; Hsh49; SAP49; SF3b49
Titer >1*10^10 GC/mL
Related Diseases Hepatocellular carcinoma
Target Gene
Gene ID 10262
Uniprot ID Q15427

Related Products