shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(SLC9A11-shRNA-Seq1)(CAT#: AdV-SI0125WQ)
This product is a SLC9A11-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. SLC9A11 is a member of the sodium-hydrogen exchanger (NHE) family and involved in pH regulation. The expression of SLC9A11-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | HAdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Insert | SLC9A11-shRNA-Seq1 |
Related Target/Protein | SLC9A11 |
Region | 3UTR |
TargetSeq | GTCAGGTTAAAGACCAAACTA |
NCBI RefSeq | NM_178527 |
Alternative Names | SLC9C2 |
Titer | >1*10^10 GC/mL |
Related Diseases | Endometrial cancer |