shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(SPACA7-shRNA-Seq1)(CAT#: AdV-SI0094WQ)
This product is a SPACA7-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The SPACA7 gene is involved in fertilization and seems not to play a direct role in sperm-egg binding or gamete fusion. The expression of SPACA7-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | SPACA7-shRNA-Seq1 |
| Related Target/Protein | SPACA7 |
| Region | CDS |
| TargetSeq | GCGATCCTTCTGAGAATTATC |
| NCBI RefSeq | NM_145248 |
| Alternative Names | C13orf28 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Infertility |