shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(SPACA7-shRNA-Seq3)(CAT#: AdV-SI0096WQ)

This product is a SPACA7-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The SPACA7 gene is involved in fertilization and seems not to play a direct role in sperm-egg binding or gamete fusion. The expression of SPACA7-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert SPACA7-shRNA-Seq3
Related Target/Protein SPACA7
Region CDS
TargetSeq GCGAAATGCCAAGTACAGCAT
NCBI RefSeq NM_145248
Alternative Names C13orf28
Titer >1*10^10 GC/mL
Related Diseases Infertility
Target Gene
Gene ID 122258
Uniprot ID Q96KW9

Related Products