shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(Sval3-shRNA-Seq1)(CAT#: AdV-SI1894WQ)

This product is a Sval3-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by Sval3 gene has the aspartic-type endopeptidase activity. The expression of Sval3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert Sval3-shRNA-Seq1
Related Target/Protein Sval3
Region CDS
TargetSeq CAATAGAAACAAGTCACTTTC
NCBI RefSeq NM_001003952
Titer >1*10^10 GC/mL
Target Gene
Gene ID 387564
Uniprot ID Q76I99

Related Products