shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(Tha1-shRNA-Seq1)(CAT#: AdV-SI2239WQ)
This product is a Tha1-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by Tha1 gene has L-allo-threonine aldolase activity. The expression of Tha1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | AdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Modification | ΔE1/E3 |
| Insert | Tha1-shRNA-Seq1 |
| Related Target/Protein | Tha1 |
| Region | 3UTR |
| TargetSeq | CTGGAGGATGGTGACATCATT |
| NCBI RefSeq | NM_027919 |
| Alternative Names | GLY1; 1300017K07Rik |
| Titer | >1*10^10 GC/mL |
