shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(Tmem146-shRNA-Seq1)(CAT#: AdV-SI1976WQ)

This product is a Tmem146-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The Tmem146 gene encodes auxiliary component of the CatSper complex, a complex involved in sperm cell hyperactivation. The expression of Tmem146-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert Tmem146-shRNA-Seq1
Related Target/Protein Tmem146
Region CDS
TargetSeq CCAGGATGACCTGATAGTATT
NCBI RefSeq XM_001052081
Alternative Names CATSPERD
Titer >1*10^10 GC/mL
Related Diseases Infertility
Target Gene
Gene ID 257062
Uniprot ID Q86XM0

Related Products