shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(TMEM177-shRNA-Seq1)(CAT#: AdV-SI1804WQ)

This product is a TMEM177-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The preotien encoded by TMEM177 gene plays a role in the early steps of cytochrome c oxidase subunit II (MT-CO2/COX2) maturation. The expression of TMEM177-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert TMEM177-shRNA-Seq1
Related Target/Protein TMEM177
Region CDS
TargetSeq CAGACACTTGTTCCGAATCAA
NCBI RefSeq NM_030577
Titer >1*10^10 GC/mL
Target Gene
Gene ID 80775
Uniprot ID Q53S58

Related Products