shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(TRABD-shRNA-Seq1)(CAT#: AdV-SI0248WQ)
This product is a TRABD-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The TRABD encodes metalloprotease that acts as a negative regulator of the Wnt signaling pathway by mediating the cleavage of the 8 N-terminal residues of a subset of Wnt proteins. The expression of TRABD-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | TRABD-shRNA-Seq1 |
| Related Target/Protein | TRABD |
| Region | CDS |
| TargetSeq | CGACGTCTACCTAACCTACAT |
| NCBI RefSeq | NM_025204 |
| Alternative Names | LP6054; PP2447 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Graves' Disease |