shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(TSR2-shRNA-Seq1)(CAT#: AdV-SI0281WQ)
This product is a TSR2-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The protein encoded by TSR2 gene appears to repress the transcription of NF-kappaB and may be involved in apoptosis. Defects in this gene are a cause of Diamond-Blackfan anemia. The expression of TSR2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | HAdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Insert | TSR2-shRNA-Seq1 |
Related Target/Protein | TSR2 |
Region | CDS |
TargetSeq | GAGGTCACAGCTACGAATGAT |
NCBI RefSeq | NM_058163 |
Alternative Names | WGG1; DBA14; DT1P1A10 |
Titer | >1*10^10 GC/mL |
Related Diseases | Diamond-Blackfan anemia |