shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(TTC18-shRNA-Seq1)(CAT#: AdV-SI0112WQ)
This product is a TTC18-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The TTC18 gene ecoded protein is a novel axoneme-binding protein that localizes at the base of the outer dynein arm and regulates ciliary motility. The expression of TTC18-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | TTC18-shRNA-Seq1 |
| Related Target/Protein | TTC18 |
| Region | CDS |
| TargetSeq | CAAGAGTTCCTCTGGTCACTA |
| NCBI RefSeq | NM_145170 |
| Alternative Names | CFAP70 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Outer dynein arm (ODA) |
