shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(Vmn1r85-shRNA-Seq7)(CAT#: AdV-SI1995WQ)

This product is a Vmn1r85-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The Vmn1r85 gene has pheromone binding and pheromone receptor activity. The expression of Vmn1r85-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert Vmn1r85-shRNA-Seq7
Related Target/Protein Vmn1r85
Region CDS
TargetSeq CAATCATATTTGCTATGATAC
NCBI RefSeq NM_145847
Alternative Names V1rj3
Titer >1*10^10 GC/mL
Target Gene
Gene ID 252909
Uniprot ID Q8VIB8

Related Products