shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(WDR74-shRNA-Seq1)(CAT#: AdV-SI0451WQ)
This product is a WDR74-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The WDR74 gene participates in an early cleavage of the pre-rRNA processing pathway in cooperation with NVL and is required for blastocyst formation, is necessary for RNA transcription, processing and/or stability during preimplantation development. The expression of WDR74-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | WDR74-shRNA-Seq1 |
| Related Target/Protein | WDR74 |
| Region | CDS |
| TargetSeq | CTAGAAGACACAGAGACAGAT |
| NCBI RefSeq | NM_018093 |
| Alternative Names | Nsa1 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Mammary adenocarcinoma |
