shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(Zfand2a-shRNA-Seq1)(CAT#: AdV-SI2216WQ)
This product is a Zfand2a-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by Zfand2a gene has zinc ion binding ability. The expression of Zfand2a-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | AdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Modification | ΔE1/E3 |
| Insert | Zfand2a-shRNA-Seq1 |
| Related Target/Protein | Zfand2a |
| Region | CDS |
| TargetSeq | CAATAACATGCGACGCCTGTA |
| NCBI RefSeq | NM_133349 |
| Alternative Names | AIRAP |
| Titer | >1*10^10 GC/mL |
