shRNA Lentivirus (self-inactivating), p7SK-(2700062C07Rik-shRNA-Seq1)(CAT#: LV-SI3924WQ)

Datasheet

This product is a 2700062C07Rik-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of 2700062C07Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert 2700062C07Rik-shRNA-Seq1
Related Target/Protein 2700062C07Rik
Region CDS
TargetSeq GAAACACTTCTCTCAACTAAA
NCBI RefSeq NM_026529
Alternative Names C87515; AI195775
Titer >1*10^10 GC/mL
Target Gene
Gene ID 68046
Uniprot ID A0A3Q4EGR9

Related Products

shRNA Lentivirus (self-inactivating), p7SK-(2010110P09Rik-shRNA-Seq2) (CAT#:LV-SI3778WQ) Recombinant lentivirus, pU6-(Human S100A9 promoter), Overexpression (CAT#:Lenti-GTOH0678WQ) Recombinant lentivirus, pU6-(Human hsa-mir-106b), Overexpression (CAT#:Lenti-GTOH0242WQ) shRNA Lentivirus (self-inactivating), p7SK-(SPANXN4-shRNA-Seq2) (CAT#:LV-SI1353WQ) shRNA Lentivirus (self-inactivating), p7SK-(Lactb2-shRNA-Seq2) (CAT#:LV-SI3634WQ) shRNA Lentivirus (self-inactivating), pH1-(Tha1-shRNA-Seq1) (CAT#:LV-SI3089WQ) shRNA Lentivirus (self-inactivating), pU6-(ENSMUSG00000063277-shRNA-Seq4) (CAT#:LV-SI2198WQ) Recombinant lentivirus, pU6-(Human cytosine-5), Overexpression (CAT#:Lenti-GTOH0593WQ)