shRNA Lentivirus (self-inactivating), p7SK-(4933405O20Rik-shRNA-Seq1)(CAT#: LV-SI3917WQ)
This product is a 4933405O20Rik-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by 4933405O20Rik gene is regulatory subunit which plays a role in the allosteric regulation of the enzyme catalyzing the decarboxylation of isocitrate (ICT) into alpha-ketoglutarate. The expression of 4933405O20Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | 4933405O20Rik-shRNA-Seq1 |
Related Target/Protein | 4933405O20Rik |
Region | CDS |
TargetSeq | CTTCACCAAAGTATGGAGGAA |
NCBI RefSeq | NM_172901 |
Titer | >1*10^10 GC/mL |