shRNA Lentivirus (self-inactivating), p7SK-(4933405O20Rik-shRNA-Seq1)(CAT#: LV-SI3917WQ)

This product is a 4933405O20Rik-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by 4933405O20Rik gene is regulatory subunit which plays a role in the allosteric regulation of the enzyme catalyzing the decarboxylation of isocitrate (ICT) into alpha-ketoglutarate. The expression of 4933405O20Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert 4933405O20Rik-shRNA-Seq1
Related Target/Protein 4933405O20Rik
Region CDS
TargetSeq CTTCACCAAAGTATGGAGGAA
NCBI RefSeq NM_172901
Titer >1*10^10 GC/mL
Target Gene
Gene ID 243996
Uniprot ID Q8BPC6

Related Products