shRNA Lentivirus (self-inactivating), p7SK-(AARSD1-shRNA-Seq3)(CAT#: LV-SI1347WQ)

This product is a AARSD1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The AARSD1 gene functions in trans to edit the amino acid moiety from incorrectly charged tRNA(Ala). The expression of AARSD1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert AARSD1-shRNA-Seq3
Related Target/Protein AARSD1
Region CDS
TargetSeq CCTGATATTTCTGTCTGGGAA
NCBI RefSeq NM_025267
Titer >1*10^10 GC/mL
Related Diseases Breast cancer
Target Gene
Gene ID 80755
Uniprot ID Q9BTE6

Related Products