shRNA Lentivirus (self-inactivating), p7SK-(Adm2-shRNA-Seq1)(CAT#: LV-SI3661WQ)
This product is a Adm2-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Adm2 gene encodes a member of the calcitonin gene-related peptide (CGRP)/calcitonin family of hormones that play a role in the regulation of cardiovascular homeostasis. The expression of Adm2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | Adm2-shRNA-Seq1 |
| Related Target/Protein | Adm2 |
| Region | 3UTR |
| TargetSeq | CTATGAGGATATGTGGATCTA |
| NCBI RefSeq | NM_182928 |
| Alternative Names | AM2; dJ579N16.4 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Gastrointestinal and cardiovascular disease |