shRNA Lentivirus (self-inactivating), p7SK-(Ammecr1-shRNA-Seq1)(CAT#: LV-SI4001WQ)
This product is a Ammecr1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. Submicroscopic deletion of the Ammecr1 may result in a contiguous gene deletion syndrome, the AMME complex. The expression of Ammecr1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | Ammecr1-shRNA-Seq1 |
Related Target/Protein | Ammecr1 |
Region | 3UTR |
TargetSeq | GCCTCATGTTATAGAACAATT |
NCBI RefSeq | NM_019496 |
Alternative Names | MFHIEN; AMMERC1 |
Titer | >1*10^10 GC/mL |
Related Diseases | Alport syndrome, mental retardation, midface hypoplasia, and elliptocytosis |