shRNA Lentivirus (self-inactivating), p7SK-(APBA3-shRNA-Seq3)(CAT#: LV-SI1315WQ)
This product is a APBA3-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by APBA3 gene is a member of the X11 protein family. It is an adapter protein that interacts with the Alzheimer's disease amyloid precursor protein. The expression of APBA3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | APBA3-shRNA-Seq3 |
| Related Target/Protein | APBA3 |
| Region | CDS |
| TargetSeq | CACCAAGAGGATCAAGGTCTT |
| NCBI RefSeq | NM_004886 |
| Alternative Names | X11L2; mint3; MGC:15815 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Alzheimer's disease |