shRNA Lentivirus (self-inactivating), p7SK-(Arhgap22-shRNA-Seq1)(CAT#: LV-SI3926WQ)
This product is a Arhgap22-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by Arhgap22 gene is Rho GTPase-activating protein involved in the signal transduction pathway that regulates endothelial cell capillary tube formation during angiogenesis. The expression of Arhgap22-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | Arhgap22-shRNA-Seq1 |
| Related Target/Protein | Arhgap22 |
| Region | CDS |
| TargetSeq | CCACTCAGATGTCAATAAGAT |
| NCBI RefSeq | NM_153800 |
| Alternative Names | RhoGAP2; RhoGap22 |
| Titer | >1*10^10 GC/mL |
