shRNA Lentivirus (self-inactivating), p7SK-(Atat1-shRNA-Seq1)(CAT#: LV-SI4026WQ)

This product is a Atat1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Atat1 gene encodes a protein that localizes to clathrin-coated pits, where it acetylates alpha tubulin on lysine 40. The expression of Atat1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert Atat1-shRNA-Seq1
Related Target/Protein Atat1
Region CDS
TargetSeq CCCACAGGTGAACAACTTTGT
NCBI RefSeq NM_028476
Alternative Names TAT; MEC17; C6orf134; Nbla00487; alpha-TAT; alpha-TAT1
Titer >1*10^10 GC/mL
Target Gene
Gene ID 79969
Uniprot ID Q5SQI0

Related Products