shRNA Lentivirus (self-inactivating), p7SK-(BC027231-shRNA-Seq1)(CAT#: LV-SI3683WQ)
This product is a BC027231-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The BC027231 gene may play a role in cortex development as part of the Notch signaling pathway. The expression of BC027231-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | BC027231-shRNA-Seq1 |
Related Target/Protein | BC027231 |
Region | CDS |
TargetSeq | CAAACTTCTTAAGAGTAATAG |
NCBI RefSeq | NM_145972 |
Alternative Names | Nepro |
Titer | >1*10^10 GC/mL |
Related Diseases | Neuronal differentiation and embryo development |