shRNA Lentivirus (self-inactivating), p7SK-(BC027231-shRNA-Seq4)(CAT#: LV-SI3686WQ)

This product is a BC027231-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The BC027231 gene may play a role in cortex development as part of the Notch signaling pathway. The expression of BC027231-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert BC027231-shRNA-Seq4
Related Target/Protein BC027231
Region CDS
TargetSeq CAGATGACATTGATGATATTT
NCBI RefSeq NM_145972
Alternative Names Nepro
Titer >1*10^10 GC/mL
Related Diseases Neuronal differentiation and embryo development
Target Gene
Gene ID 212547
Uniprot ID Q8R2U2

Related Products