shRNA Lentivirus (self-inactivating), p7SK-(Bcdin3d-shRNA-Seq1)(CAT#: LV-SI3950WQ)
This product is a Bcdin3d-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Bcdin3d gene encodes an RNA methyltransferase which belongs to the rossmann fold methyltransferase family, and serves as a 5'-methylphosphate capping enzyme that is specific for cytoplasmic histidyl tRNA. The expression of Bcdin3d-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | Bcdin3d-shRNA-Seq1 |
| Related Target/Protein | Bcdin3d |
| Region | CDS |
| TargetSeq | CTCTGTACAAACATTTCCTTT |
| NCBI RefSeq | NM_029236 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Breast cancer |