shRNA Lentivirus (self-inactivating), p7SK-(Bcdin3d-shRNA-Seq1)(CAT#: LV-SI3950WQ)
This product is a Bcdin3d-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Bcdin3d gene encodes an RNA methyltransferase which belongs to the rossmann fold methyltransferase family, and serves as a 5'-methylphosphate capping enzyme that is specific for cytoplasmic histidyl tRNA. The expression of Bcdin3d-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | Bcdin3d-shRNA-Seq1 |
Related Target/Protein | Bcdin3d |
Region | CDS |
TargetSeq | CTCTGTACAAACATTTCCTTT |
NCBI RefSeq | NM_029236 |
Titer | >1*10^10 GC/mL |
Related Diseases | Breast cancer |