shRNA Lentivirus (self-inactivating), p7SK-(BTBD9-shRNA-Seq1)(CAT#: LV-SI1415WQ)
This product is a BTBD9-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The BTBD9 gene encodes a BTB/POZ domain-containing protein. This domain is known to be involved in protein-protein interactions. The expression of BTBD9-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | BTBD9-shRNA-Seq1 |
Related Target/Protein | BTBD9 |
Region | CDS |
TargetSeq | CCGTACATGATTGGGTCAATA |
NCBI RefSeq | NM_152733 |
Alternative Names | dJ322I12.1 |
Titer | >1*10^10 GC/mL |
Related Diseases | Tourette Syndrome |