shRNA Lentivirus (self-inactivating), p7SK-(C11orf76-shRNA-Seq1)(CAT#: LV-SI1226WQ)

This product is a C11orf76-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of C11orf76-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert C11orf76-shRNA-Seq1
Related Target/Protein C11orf76
Region CDS
TargetSeq GAAGAAACCGAGTGAGGATGA
NCBI RefSeq NM_145308
Alternative Names SHANK2-AS3
Titer >1*10^10 GC/mL
Target Gene
Gene ID 220070
Uniprot ID Q9BTD1

Related Products