shRNA Lentivirus (self-inactivating), p7SK-(C11orf76-shRNA-Seq2)(CAT#: LV-SI1227WQ)
This product is a C11orf76-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of C11orf76-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | C11orf76-shRNA-Seq2 |
| Related Target/Protein | C11orf76 |
| Region | 3UTR |
| TargetSeq | GTGAGAGAATGTTTCTGATAA |
| NCBI RefSeq | NM_145308 |
| Alternative Names | SHANK2-AS3 |
| Titer | >1*10^10 GC/mL |