shRNA Lentivirus (self-inactivating), p7SK-(C11orf76-shRNA-Seq3)(CAT#: LV-SI1228WQ)
This product is a C11orf76-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of C11orf76-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | C11orf76-shRNA-Seq3 |
Related Target/Protein | C11orf76 |
Region | 3UTR |
TargetSeq | GCCCATCATTTGGAAAGGGAA |
NCBI RefSeq | NM_145308 |
Alternative Names | SHANK2-AS3 |
Titer | >1*10^10 GC/mL |