shRNA Lentivirus (self-inactivating), p7SK-(C17orf77-shRNA-Seq1)(CAT#: LV-SI1204WQ)

This product is a C17orf77-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of C17orf77-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert C17orf77-shRNA-Seq1
Related Target/Protein C17orf77
Region CDS
TargetSeq CATCTGTAGCTACTTCTCTTT
NCBI RefSeq NM_152460
Titer >1*10^10 GC/mL
Target Gene
Gene ID 146723
Uniprot ID Q96MU5

Related Products