shRNA Lentivirus (self-inactivating), p7SK-(C1QL4-shRNA-Seq1)(CAT#: LV-SI1436WQ)
This product is a C1QL4-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The C1QL4 gene may regulate the number of excitatory synapses that are formed on hippocampus neurons. The expression of C1QL4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | C1QL4-shRNA-Seq1 |
| Related Target/Protein | C1QL4 |
| Region | CDS |
| TargetSeq | CCAACAAGTACAGCACCTTCT |
| NCBI RefSeq | NM_001008223 |
| Alternative Names | CTRP11; C1QTNF11 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Coronary artery disease |