shRNA Lentivirus (self-inactivating), p7SK-(C1QL4-shRNA-Seq1)(CAT#: LV-SI1436WQ)

This product is a C1QL4-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The C1QL4 gene may regulate the number of excitatory synapses that are formed on hippocampus neurons. The expression of C1QL4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert C1QL4-shRNA-Seq1
Related Target/Protein C1QL4
Region CDS
TargetSeq CCAACAAGTACAGCACCTTCT
NCBI RefSeq NM_001008223
Alternative Names CTRP11; C1QTNF11
Titer >1*10^10 GC/mL
Related Diseases Coronary artery disease
Target Gene
Gene ID 338761
Uniprot ID Q86Z23

Related Products