shRNA Lentivirus (self-inactivating), p7SK-(C1qtnf3-shRNA-Seq2)(CAT#: LV-SI3572WQ)
This product is a C1qtnf3-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of C1qtnf3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | C1qtnf3-shRNA-Seq2 |
Related Target/Protein | C1qtnf3 |
Region | CDS |
TargetSeq | GATGTCATGACTGGGAGATTT |
NCBI RefSeq | NM_030888 |
Alternative Names | CORS; CORCS; CTRP3; CORS26; C1ATNF3; CORS-26 |
Titer | >1*10^10 GC/mL |