shRNA Lentivirus (self-inactivating), p7SK-(C22orf39-shRNA-Seq1)(CAT#: LV-SI1409WQ)
This product is a C22orf39-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The absence of the C22orf39 gene may be critical for inducing tumorigenesis. The expression of C22orf39-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | C22orf39-shRNA-Seq1 |
| Related Target/Protein | C22orf39 |
| Region | 3UTR |
| TargetSeq | GCGATGTTCTGCAGGACAATT |
| NCBI RefSeq | NM_173793 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Liver cancer |