shRNA Lentivirus (self-inactivating), p7SK-(C4orf41-shRNA-Seq2)(CAT#: LV-SI1244WQ)

Datasheet

This product is a C4orf41-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by C4orf41 gene is a subunit of the TRAPP (transport protein particle) tethering complex, which functions in intracellular vesicle trafficking. The expression of C4orf41-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert C4orf41-shRNA-Seq2
Related Target/Protein C4orf41
Region 3UTR
TargetSeq CATGAAAGAATGTCAGACCAT
NCBI RefSeq NM_021942
Alternative Names GRY; FOIGR; LGMD2S; TRAPPC11; LGMDR18
Titer >1*10^10 GC/mL
Target Gene
Gene ID 60684
Uniprot ID Q7Z392

Related Products

shRNA Lentivirus (self-inactivating), pU6-(OR51F1-shRNA-Seq4) (CAT#:LV-SI2174WQ) Recombinant lentivirus, pU6-(Human Map3k11 3'UTR), Overexpression (CAT#:Lenti-GTOH0160WQ) shRNA Lentivirus (self-inactivating), pU6-(N4bp2-shRNA-Seq4) (CAT#:LV-SI1926WQ) shRNA Lentivirus (self-inactivating), pU6-(PRR14-shRNA-Seq2) (CAT#:LV-SI0433WQ) shRNA Lentivirus (self-inactivating), p7SK-(Tmem231-shRNA-Seq1) (CAT#:LV-SI3522WQ) shRNA Lentivirus (self-inactivating), p7SK-(OR5B12-shRNA-Seq4) (CAT#:LV-SI3352WQ) shRNA Lentivirus (self-inactivating), pH1-(Pomp-shRNA-Seq3) (CAT#:LV-SI2577WQ) shRNA Lentivirus (self-inactivating), pH1-(SPAG17-shRNA-Seq2) (CAT#:LV-SI0723WQ)