shRNA Lentivirus (self-inactivating), p7SK-(CCDC11-shRNA-Seq2)(CAT#: LV-SI1485WQ)

This product is a CCDC11-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The CCDC11 gene belongs to the CFAP53 family. It was found to be differentially expressed by the ciliated cells of frog epidermis and in skin fibroblasts from human. The expression of CCDC11-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert CCDC11-shRNA-Seq2
Related Target/Protein CCDC11
Region CDS
TargetSeq CGAACAGGACTTGAACATGAA
NCBI RefSeq NM_145020
Alternative Names HTX6; CFAP53
Titer >1*10^10 GC/mL
Related Diseases Visceral heterotaxy-6
Target Gene
Gene ID 220136
Uniprot ID Q96M91

Related Products