shRNA Lentivirus (self-inactivating), p7SK-(CCDC80-shRNA-Seq2)(CAT#: LV-SI1494WQ)

This product is a CCDC80-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The CCDC80 gene promotes cell adhesion and matrix assembly. The expression of CCDC80-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert CCDC80-shRNA-Seq2
Related Target/Protein CCDC80
Region CDS
TargetSeq GAGTGTTAGAACTGTTCCCAA
NCBI RefSeq NM_199511
Alternative Names CL2; URB; DRO1; SSG1; okuribin
Titer >1*10^10 GC/mL
Related Diseases Metabolic disease
Target Gene
Gene ID 151887
Uniprot ID Q76M96

Related Products