shRNA Lentivirus (self-inactivating), p7SK-(CCDC84-shRNA-Seq1)(CAT#: LV-SI4040WQ)
This product is a CCDC84-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The CCDC84 gene encodes a protein thought to contain a coiled coil motif. The expression of CCDC84-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | CCDC84-shRNA-Seq1 |
| Related Target/Protein | CCDC84 |
| Region | CDS |
| TargetSeq | GCACAAGAAAGCAACCAACAA |
| NCBI RefSeq | NM_198489 |
| Alternative Names | DLNB14 |
| Titer | >1*10^10 GC/mL |
