shRNA Lentivirus (self-inactivating), p7SK-(CLMP-shRNA-Seq2)(CAT#: LV-SI1100WQ)

This product is a CLMP-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The CLMP gene encodes a type I transmembrane protein that is localized to junctional complexes between endothelial and epithelial cells and may have a role in cell-cell adhesion. The expression of CLMP-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert CLMP-shRNA-Seq2
Related Target/Protein CLMP
Region CDS
TargetSeq CAGAAGGAAGTGACCTGACTT
NCBI RefSeq NM_024769
Alternative Names ACAM; ASAM; CSBM; CSBS
Titer >1*10^10 GC/mL
Related Diseases Congenital short bowel syndrome
Target Gene
Gene ID 79827
Uniprot ID Q9H6B4

Related Products