shRNA Lentivirus (self-inactivating), p7SK-(COG6-shRNA-Seq1)(CAT#: LV-SI3989WQ)

Datasheet

This product is a COG6-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The COG6 gene encodes a subunit of the conserved oligomeric Golgi complex that is required for maintaining normal structure and activity of the Golgi apparatus. The expression of COG6-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert COG6-shRNA-Seq1
Related Target/Protein COG6
Region CDS
TargetSeq CGTGGAGATATTGAACGTAAA
NCBI RefSeq NM_020751
Alternative Names COD2; SHNS; CDG2L
Titer >1*10^10 GC/mL
Target Gene
Gene ID 57511
Uniprot ID Q9Y2V7

Related Products

Recombinant lentivirus, pU6-(Rattus HIF-1a), Overexpression (CAT#:Lenti-GTOH0281WQ) shRNA Lentivirus (self-inactivating), pU6-(Olfr1395-shRNA-Seq2) (CAT#:LV-SI2049WQ) shRNA Lentivirus (self-inactivating), pH1-(C1QL4-shRNA-Seq1) (CAT#:LV-SI0935WQ) shRNA Lentivirus (self-inactivating), pH1-(TMEM167B-shRNA-Seq2) (CAT#:LV-SI2355WQ) shRNA Lentivirus (self-inactivating), pU6-(D730001G18Rik-shRNA-Seq1) (CAT#:LV-SI2349WQ) shRNA Lentivirus (self-inactivating), p7SK-(TMEM60-shRNA-Seq1) (CAT#:LV-SI1233WQ) shRNA Lentivirus (self-inactivating), pH1-(OR4K5-shRNA-Seq7) (CAT#:LV-SI2558WQ) shRNA Lentivirus (self-inactivating), pU6-(OR4S2-shRNA-Seq1) (CAT#:LV-SI2128WQ)