shRNA Lentivirus (self-inactivating), p7SK-(CREG2-shRNA-Seq1)(CAT#: LV-SI1235WQ)
This product is a CREG2-shRNA encoding Lentivirus, which is based on HIV-1 serotype. Human and mouse CREG2 are putative secreted glycoproteins and may be novel neuronal extracellular molecules. The expression of CREG2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | CREG2-shRNA-Seq1 |
| Related Target/Protein | CREG2 |
| Region | CDS |
| TargetSeq | CAGTATTTCAAGGGAGGAATA |
| NCBI RefSeq | NM_153836 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Brain disease |