shRNA Lentivirus (self-inactivating), p7SK-(D730001G18Rik-shRNA-Seq1)(CAT#: LV-SI4049WQ)
This product is a D730001G18Rik-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by D730001G18Rik has acetylcholine receptor inhibitor activity. The expression of D730001G18Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | D730001G18Rik-shRNA-Seq1 |
| Related Target/Protein | D730001G18Rik |
| Region | CDS |
| TargetSeq | CCTCTATGAGACCTTCAGAGT |
| NCBI RefSeq | NM_172433 |
| Alternative Names | Ly6g6g |
| Titer | >1*10^10 GC/mL |
| Target Gene | |
|---|---|
| Gene ID | 78725 |
| Uniprot ID | A0A087WQU7 |
