shRNA Lentivirus (self-inactivating), p7SK-(DEPDC1-shRNA-Seq3)(CAT#: LV-SI1068WQ)

This product is a DEPDC1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The DEPDC1 gene may be involved in transcriptional regulation as a transcriptional corepressor. The expression of DEPDC1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert DEPDC1-shRNA-Seq3
Related Target/Protein DEPDC1
Region 3UTR
TargetSeq CCCACTGAAATCAGGGCATAT
NCBI RefSeq NM_017779
Alternative Names DEP.8; SDP35; DEPDC1A; DEPDC1-V2
Titer >1*10^10 GC/mL
Related Diseases Bladder cancer
Target Gene
Gene ID 55635
Uniprot ID Q5TB30

Related Products