shRNA Lentivirus (self-inactivating), p7SK-(DHX15-shRNA-Seq2)(CAT#: LV-SI1009WQ)

This product is a DHX15-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by DHX15 is a putative ATP-dependent RNA helicase implicated in pre-mRNA splicing. Misregulation of this gene has been implicated in tumorigenesis. The expression of DHX15-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert DHX15-shRNA-Seq2
Related Target/Protein DHX15
Region CDS
TargetSeq ACTGTTCTAATGAGGTCCTAT
NCBI RefSeq NM_001358
Alternative Names DBP1; HRH2; DDX15; PRP43; PRPF43; PrPp43p
Titer >1*10^10 GC/mL
Related Diseases Acute myeloid leukemia (AML)
Target Gene
Gene ID 1665
Uniprot ID O43143

Related Products