shRNA Lentivirus (self-inactivating), p7SK-(Dos-shRNA-Seq1)(CAT#: LV-SI3994WQ)
This product is a Dos-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by Dos gene negatively regulates voltage-gated calcium channels by preventing the interaction between their alpha and beta subunits. The expression of Dos-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | Dos-shRNA-Seq1 |
Related Target/Protein | Dos |
Region | CDS |
TargetSeq | GCCGACTTCATTCAGTACATT |
NCBI RefSeq | NM_015761 |
Alternative Names | DOS; BARP; C19orf26; CBARP |
Titer | >1*10^10 GC/mL |