shRNA Lentivirus (self-inactivating), p7SK-(Eif4h-shRNA-Seq2)(CAT#: LV-SI3629WQ)
This product is a Eif4h-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Eif4h gene encodes one of the translation initiation factors, which functions to stimulate the initiation of protein synthesis at the level of mRNA utilization. The expression of Eif4h-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | Eif4h-shRNA-Seq2 |
Related Target/Protein | Eif4h |
Region | CDS |
TargetSeq | GGGTTCTGCTATGTAGAATTT |
NCBI RefSeq | NM_033561 |
Alternative Names | WSCR1; WBSCR1; eIF-4H |
Titer | >1*10^10 GC/mL |
Related Diseases | Williams syndrome |