shRNA Lentivirus (self-inactivating), p7SK-(F8-shRNA-Seq2)(CAT#: LV-SI1262WQ)

This product is a F8-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The F8 gene encodes coagulation factor VIII, which participates in the intrinsic pathway of blood coagulation; factor VIII is a cofactor for factor IXa which, in the presence of Ca+2 and phospholipids, converts factor X to the activated form Xa. The expression of F8-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert F8-shRNA-Seq2
Related Target/Protein F8
Region 3UTR
TargetSeq GCCTCCTGAATTAACTATCAT
NCBI RefSeq NM_000132
Alternative Names AHF; F8B; F8C; HEMA; FVIII; DXS1253E
Titer >1*10^10 GC/mL
Related Diseases Hemophilia A, a common recessive X-linked coagulation disorder
Target Gene
Gene ID 2157
Uniprot ID P00451

Related Products