shRNA Lentivirus (self-inactivating), p7SK-(GOLM1-shRNA-Seq2)(CAT#: LV-SI1134WQ)

This product is a GOLM1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by GOLM1 is a type II Golgi transmembrane protein. It processes proteins synthesized in the rough endoplasmic reticulum and assists in the transport of protein cargo through the Golgi apparatus. The expression of this gene has been observed to be upregulated in response to viral infection. The expression of GOLM1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert GOLM1-shRNA-Seq2
Related Target/Protein GOLM1
Region CDS
TargetSeq GCAGGGAATGACAGAAACATA
NCBI RefSeq NM_016548
Alternative Names GP73; HEL46; GOLPH2; C9orf155; PSEC0257; bA379P1.3
Titer >1*10^10 GC/mL
Related Diseases Prostate cancer
Target Gene
Gene ID 51280
Uniprot ID Q8NBJ4

Related Products